Azilsartan prevented AGE‐induced inflammatory response anddegradation ofaggrecan inhuman chondrocytes through inhibition of Sox4

Jie Lei1|Mengyin He2|Wei Wang1

Abstract

Advanced glycation end products (AGEs)‐induced inflammation and degradation of aggrecan in human chondrocytes play an important role in the progression and development of osteoarthritis (OA). Azilsartan, an angiotensin II receptor antagonist, has been licensed for the treatment of high blood pressure. However, the effects of Azilsartan in OA and AGEs‐induced damages in chondrocytes have not been previously reported. The injured chondrocytes model was established by incubating with 5 μmol/L AGEs. 3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide was used to evaluate the cell viability of treated SW1353 cells. The gene expression levels of interleukin‐1α (IL‐1α), tumor necrosis factor‐β (TNF‐β), IL‐6, a disintegrin‐like and metallopeptidase with thrombospondin type motif‐4 (ADAMTS‐4), ADAMTS‐5, Aggrecan, and Sox‐4 were evaluated using quantitative real‐time polymerase chain reaction and their protein levels were determined using enzyme‐linked immunosorbent assay or Western blot analysis. Mitogen‐activated protein kinase p38 pathway was surveyed using phosp‐p38 level and its specific inhibitor SB203580 was employed to block the p38 pathway. The overexpression of Sox4 plasmid was transfected into SW1353 cells to assess its regulation on ADAMTS‐4 and ADAMTS‐5. Azilsartan reduced AGEs‐induced production of proinflammatory cytokines, such as IL‐1α, TNF‐β, and IL‐6. Azilsartan prevented AGEs‐induced expressions of ADAMTS‐4 and ADAMTS‐5 as well as the reduction of aggrecan. Mechanistically, AGEs treatment increased the expression of Sox4 in a dose‐dependent manner. AGE treatment increased the level of phosphorylated p38. However, treatment with the p38 inhibitor SB203580 inhibited AGEs‐induced expression of Sox4, suggesting that AGEs‐induced expression of Sox4 is mediated by p38. Furthermore, Azilsartan suppressed AGEs‐induced phosphorylation of p38 and expression of Sox4. Finally, the overexpression of Sox4 abolished the inhibitory effects of Azilsartan against the expressions of ADAMTS‐4 and ADAMTS‐5. Azilsartan treatment prevented AGEs‐induced inflammatory response and degradation of aggrecan through inhibition of Sox4.

KEYWORDS
advanced glycation end products, aggrecan, Azilsartan, osteoarthritis, Sox4

1 | INTRODUCTION

Osteoarthritis (OA) is a debilitating joint disease characterized by excessive and irreversible degradation of the articular extracellular matrix (ECM). OA is considered the most prevalent degenerative joint disease in the world and is estimated to affect more than 25% of adults.[1,2] The pathogenesis of OA is complex. Among the numerous causative factors that drive the initiation and progression of the disease, such as genetics, mechanical stress, gender, injury, and obesity, the process of aging is considered to be a leading contributor.[3,4] Chondrocytes are the only cell type in articular cartilage and serve to facilitate smooth articulation. In healthy conditions, chondrocytes both synthesize and degrade the components of the articular ECM to maintain homeostasis. However, in OA, chondrocytes undergo abnormal phenotypic changes, and their function shifts to promote degradation over a generation. These changes also induce the release of proinflammatory cytokines and degradative enzymes by chondrocytes, thereby furthering cartilage destruction[5]
Advanced glycation end‐products (AGEs) are one of the byproducts of the Maillard process of nonenzymatic glycation. Specifically, AGEs are formed as the result of intermoiety interactions wherein carbonyl groups located on reducing sugars bind to amine residues from free amino acids, peptides, or proteins. Due to their resilience to degradation, AGEs are commonly used as food additives to aid in preservation. However, concern has been raised over the harmful biological effects of AGEs.[6] AGEs accumulate in the body over time and have been cited as a major risk factor for OA, among other age‐related diseases. AGEs have been shown to induce pathogenic modifications in the structural status of cartilage by degrading the two main components of the articular ECM, type II collagen, and aggrecan.[7–9] Additionally, AGEs promote a robust inflammatory response by triggering the release of proinflammatory cytokines, including interleukin‐1 (IL‐1), IL‐6, and tumor necrosis factors (TNFs).[10–12] Furthermore, AGEs induce the expression of a disintegrinlike and metallopeptidase with thrombospondin type motif‐4 (ADAMTS4) and ADAMTS‐5, which is mediated by sex‐determining region Y‐boxrelated high‐mobility group‐box‐4 (Sox4). ADAMTS‐4 and ADAMTS‐5 target aggrecan for degradation and play a major role in cartilage destruction in OA. Sox4 has been suggested as a therapeutic target to inhibit cartilage destruction in OA.[13]
The renin–angiotensin system (RAS) plays a vital role in regulating homeostasis and sodium balance by influencing various systems and organs, including the cardiovascular system, kidneys, and the central nervous system.[14,15] Additionally, the components of the RAS, including renin, angiotensin II (Ang II), angiotensin‐converting enzyme, and angiotensin receptors (ATRs), such as the Ang II type 1 receptor (AT1R) and the Ang II type 2 receptor, have been shown to play a significant role in inflammation, chondrocyte hypertrophy, and angiogenesis in OA.[16] ATR inhibition has shown potential as a treatment for a wide range of diseases, including hypertension, gastrointestinal disease, cancers, anxiety disorders, and OA.[17–20] Hypertension is associated with an increased risk of OA. Recent research found that increased AT1R expression is associated with the development of knee OA and that AT1R inhibition may reverse this effect by inhibiting the phosphorylation of JNK in chondrocytes. In the present study, we investigate the effects of Azilsartan, a relatively new angiotensin receptor blocker with a high affinity for AT1R that has been licensed for use in the treatment of hypertension. Compared to its predecessors valsartan, olmesartan, and candesartan, Azilsartan has demonstrated a favorable safety profile and efficacy.[21] Our findings suggest that Azilsartan has the potential to inhibit AGE‐induced inflammation and cartilage degradation via inhibition of Sox4.

2 | MATERIALS AND METHODS

2.1 | Cell culture and treatment

SW1353 cells are widely used in in vitro models of OA.[13] For the present study, human SW1353 cells were purchased from American Type Culture Collection. The cells were maintained in Dulbecco’s modified Eagle’s medium with supplemental fetal bovine serum (10%) and antibiotics (100 U/ml penicillin/streptomycin) in a humidified incubator (95% O2/5% CO2) at 37°C. SW1353 cells were passaged at split ratios of 1:3–1:4 using trypsin–ethylenediaminetetraacetic acid. For the treatment experiments, the cells were plated on a 60‐mm culture dish or a six‐well plate with the coverslip at a density of 3 × 104/cm2. After being cultured overnight, the cells were stimulated with AGEs (100 μg/ml) with or without Azilsartan (10, 20 μM) (#SML0432; Sigma‐Aldrich) for 24 h.

2.2 | 3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5diphenyltetrazolium bromide assay

SW1353 cells plated on a 96‐well plate were treated with AGEs or Azilsartan for 24 h at 37°C. To assess cell viability, 10 μl of 5 mg/ml 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) solution (Thermo Fisher Scientific) was added in the medium and incubated for 4 h. Then 200 μl of dimethyl sulfoxide was added into each well and further incubated for 2 h. Optical density value at 490 nm was recorded by a microplate reader (Synergy Neo2; BioTek).

2.3 | Real‐time polymerase chain reaction analysis

Real‐time polymerase chain reaction (RT‐PCR) analysis was used to determine the messenger RNA (mRNA) expression of the target genes IL‐1α, IL‐6, TNF‐β, ADAMTS‐4, and ADAMTS‐5. Briefly, after the treatment of the cells with AGEs or Azilsartan for 24 h, RNA was isolated from SW1353 cells using Qiazol reagent (Qiagen) according to the product manual. The purified RNA was eluted in 10 nM TE buffer and stored at −20°C. For RT‐PCR, 5 µg RNA was reversely transcribed into complementary DNA (cDNA) as previously described.[10] The cDNA was subjected to PCR analysis with specific primers to evaluate the target gene expression on a One‐Step PCR system (ABI). The following primers were used in this study: IL‐1α (forward 5′‐GTGCTCAAAACGAA GACGAACC‐3′, reverse 5′‐CATATTGCC ATGCTTTTCCCAGAA‐3′); TNF‐β (5′‐GCTGCTCACCTCATTGGAGAC‐3′, 5′‐ CACCATCTTCTGGG AGCTGAG‐3′); ADAMTS‐4 (forward: 5′‐ACACTGAGGACTGCCCAAC3′; reverse: 5′‐GGTGAGTTTGCACTGGTCCT‐3′); ADAMTS‐5 (forward: 5′‐GCAGAACATCGACCAACTCTACTC‐3′; reverse: 5′‐CCAGCAATGC CCACCGAAC‐3′); IL‐6 (forward: 5′‐TTGGGAAGGTTACATCAGATC‐3′; reverse: 5′‐GGGTTGGTCCATGTCAATTT‐3′); SOX‐4 (forward: 5′‐AA GATCATGGAGCAGTCGCC‐3′, reverse: 5′‐CGCCTCTCGAATGAA AGGGA‐3′); GAPDH (forward: 5′‐GACGGCCGCATCTTCTTGT‐3′, 5′CAGTGCCAGCCTCGTCCCGTAGA‐3′).

2.4 | Enzyme‐linked immunosorbent assay

To determine the protein expression of the target genes IL‐1α, IL‐6, and TNF‐α, commercial enzyme‐linked immunosorbent assay (ELISA) kits (R&D Systems) were purchased. In brief, the culture media was collected and centrifuged to remove debris. The supernatant protein was quantified using a bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific). Then 50 µl sample was used to measure the secreted protein levels and the procedure was performed by following the manufacturer′s instructions. Standardized values were obtained using a standard curve, and a 96‐well plate spectrometry (Synergy Neo2; BioTek) was used for data collection. The data were presented as fold change with the reference to control sample.

2.5 | Western blot analysis

After treatment, cells were lysed using radioimmunoprecipitation assay buffer (Sigma‐Aldrich) supplemented with protease and phosphatase inhibitor Cocktail (#ab201119; Abcam). Protein concentrations were measured using BCA assay (#23225; Thermo Fisher Scientific). To determine the protein levels of Aggrecan, Sox4, p‐p38, proteins were separated onto sodium dodecyl sulfate‐polyacrylamide gels in accordance with the standard protocol and then transferred onto polyvinylidene difluoride–nylon membranes for analysis (Millipore). The membranes were blocked at room temperature for 1 h with 5% nonfat milk in TBST (containing 0.1% Tween‐20, 10 mM Tris‐HCl [pH7.5], and 150 mM NaCl). The membranes were then washed three times in fresh saline and incubated with following primary antibody in TBST for 2 h: Aggrecan (#ab3778, 1:500; Abcam), Sox4 (#ab70598, 1:1000; Abcam), p‐p38 (#ab178867, 1:1000; Abcam), and β‐actin (#ab8226, 1:5000; Abcam). After washing three more times with TBST, the membranes were probed with horseradish peroxidase‐conjugated secondary antibody (1:3000; Santa Cruz Biotechnology) for 30–60 min. Then, the membranes were thoroughly washed and the resulting bands were visualized using an enhanced chemiluminescence system (#34075; Pierce). Image J software was used to analyze the images.

2.6 | Cell transfection

For our Sox4 overexpression experiments, Lipofectamine RNAi Max reagent was used to transfect pCNDA3.1‐Sox4 plasmid (Addgen) into SW1353 cells. The transfected cells were cultured for 48–72 h, and successful overexpression of Sox4 was confirmed by using Western blot analysis.

2.7 | Statistical analysis

Results were presented as mean ± standard deviation (SD). All the samples appeared to be normally distributed. Statistical analysis was performed using SPSS (version 17). Analysis of variance was used for comparisons between multiple groups, followed by Tukey′s multiple comparisons test. A p‐value of less than 0.05 was considered statistically significant.

3 | RESULTS

3.1 | Cytotoxicity of Azilsartan

Azilsartan is a highly selective antagonist of the AT1 receptor.[22] The molecular structure of Azilsartan is shown in Figure 1A. In a cellbased experiment, Ahmadian et al.[23] show that Azilsartan can be used at final concentrations of 5–25 μM for 24 h without significant effect on cell viability in hepatocellular HepG2 and epithelial KDR cell lines. In our pilot experiment, the cytotoxicity of drug concentrations ranging from 1 to 200 µM was evaluated in cultured SW1353 cells using MTT assay. As shown in Figures 1B, 1–20 µM Azilsartan treatment for 24 h had no obvious effect on cell viability, while the chondrocytes treated with higher concentrations of 100 and 200 µM had 9% and 17% reduction of cell viability. Thus, we conclude that the concentrations below 20 µM are not toxic to cultured SW1353 cells, and we used 10 and 20 µM of Azilsartan in all other experiments.

3.2 | Inhibition of proinflammatory cytokines

We began by measuring the effect of Azilsartan on the expression of proinflammatory cytokines in SW1353 chondrosarcoma cell line chondrocytes stimulated with AGEs. The results in Figure 2A–C demonstrate that while exposure to AGEs significantly increased the expression levels of IL‐1α, IL‐6, and TNF‐β roughly to 3.1 ± 0.34, 3.6 ± 0.4, and 4.3 ± 0.46‐fold. However, 10 µM Azilsartan inhibited the mRNA expression of these three cytokines to 2.2 ± 0.24, 2.6 ± 0.28, and 3.1 ± 0.33‐fold. Furthermore, 20 µM Azilsartan inhibited them to 1.7 ± 0.2, 1.9 ± 0.22, and 2.4 ± 0.27‐fold. A similar inhibitory effect was observed on the protein secretion of these three cytokines, suggesting a distinct anti‐inflammatory effect of Azilsartan in OA chondrocytes (Figure 2D–F).

3.3 | Inhibition of degradative enzymes

In our next experiment, we explored whether Azilsartan would reduce the expression of the aggrecanases ADAMTS‐4 and ADAMTS‐5 induced by AGEs. The results of RT‐PCR in Figure 3A,B demonstrate that while AGEs alone significantly increased their mRNA expression to 2.8 ± 0.31 and 3.8 ± 0.42‐fold, the addition of 10 and 20 µM Azilsartan dose‐responsively reduced the expression of ADAMTS‐4 to 2.2 ± 0.25 and 1.7 ± 0.12fold and ADAMTS‐5 to 2.7 ± 0.3 and 2.1 ± 0.23‐fold. Meanwhile, the results of ELISA in Figure 3C,D show a similar effect of Azilsartan on aggrecanase expression at the protein level. Next, we employed Western blot analysis to determine whether this inhibitory effect of Azilsartan against ADAMTS‐4 and ADAMTS‐5 resulted in decreased degradation of aggrecan induced by AGEs. Indeed, the results in Figure 4 indicate that Azilsartan doseresponsively ameliorated AGE‐induced aggrecan degradation, with the higher dose rescuing aggrecan expression to near baseline.

3.4 | AGEs induce the expression of Sox4 which is mediated by p38

Sox4 upregulates the expression of ADAMTS‐4 and ADAMTS‐5, thereby contributing to cartilage degradation in OA.[13] To determine whether the inhibitory effects of Azilsartan against ADAMTS expression and aggrecan degradation described above are mediated through suppression of Sox4, we began by confirming that Sox4 expression is inducible by AGEs in a dose‐dependent manner at both the mRNA and protein levels (Figure 5A,B). Next, we determined whether p38 protein phosphorylation plays a role in the AGEinduced expression of Sox4. As shown in Figure 6A, AGEs induced the phosphorylation of p38, and the inhibition of p38 by its inhibitor SB203580 abolished the increase in Sox4 expression induced by AGEs at both the mRNA (Figure 6B) and protein levels (Figure 6C).

3.5 | Effects of Azilsartan on AGE‐induced Sox4 expression

Finally, we determined whether the protective effect of Azilsartan against AGE‐induced expression of ADAMTS‐4/5 and aggrecan degradation was mediated through the p38/Sox4 pathway. Indeed, the results in Figure 7A show that Azilsartan significantly reduced the phosphorylation of p38, which resulted in considerable downregulation of Sox4 at both the mRNA and protein levels (Figure 7B,C). To confirm whether inhibition of p38/Sox4 was indeed the mechanism through which Azilsartan reduced the ADAMTSmediated degradation of aggrecan, we transfected the cells with pCNDA3.1‐Sox4 plasmid to overexpress Sox4. Successful overexpression of Sox4 is shown in Figure 8A. As shown in Figure 8B,C, overexpression of Sox4 abolished the inhibitory effect of Azilsartan against ADAMTS‐4 and ADAMTS‐5. These findings provide evidence that Azilsartan may prevent cartilage degradation by suppressing ADAMTS‐4/−5‐mediated aggrecan degradation via inhibition of p38/Sox4.

4 | DISCUSSION

OA is the most prevalent joint disease in the world and takes a massive toll on patient mobility and quality of life. OA typically affects the spine, hips, knees, hands, and feet, but can also affect any of the synovial joints.[24] Considered to be an age‐related disease, the incidence of OA and other musculoskeletal diseases is projected to increase in the coming decades as the average age of the global population increases.[25] Due to its complex etiology, there is currently no reliable first‐line treatment for OA. Treatment regimens include land or aquatic exercise, weight management, cyclooxygenase‐2 (COX‐2) inhibitors, intra‐articular hyaluronic messenger RNA acid injection, and nonsteroidal anti‐inflammatory drugs.[26] Arthroplasty remains the preferred treatment for patients who have an inadequate response to pharmacological intervention or who suffer from late‐stage disease, but surgical intervention is not always ideal for older patients.[27] Thus, it is vitally important that safe and reliable pharmacological options are discovered. The receptor for Ang II AT1R has been shown to be expressed in articular chondrocytes, and its expression is upregulated in response to the cytokine IL‐1, which plays a key role in the pathogenesis of OA.[28] Exposure to AGEs has been shown to activate the RAS through the receptor for AGEs/phosphoinositide 3‐kinase/protein kinase B signaling pathway.[29] However, the role of AT1R in the pathogenesis of OA remains to be elucidated. Here, we present our findings that the AT1R antagonist Azilsartan may confer protective effects against cartilage destruction induced by AGEs via a Sox4‐dependent mechanism.
In recent decades, OA has been widely viewed as a chronic inflammatory disease, and AGEs are well‐recognized for their proinflammatory effects in chondrocytes. For example, a recent study showed that exposure of chondrocytes to AGEs resulted in a significant increase in the expression of pronflammatory cytokines, including COX‐2, inducible nitric oxide synthase, nitric oxide, prostaglandin E2, TNF‐α, and IL‐6, as well as increased activity of the nuclear factor‐κB (NF‐κB)/mitogen‐activated protein kinase (MAPK) pathway, thereby driving degradation of the ECM.[30] Another study found that AGE‐induced inflammation mediated by IL‐1β could promote the further accumulation of AGEs in cartilage explants from patients with age‐related OA by inhibiting the activity of the AGEscavenging enzyme glyoxalase‐1.[31] In the present study, we found that the AT1R antagonist Azilsartan inhibited the increased expression of IL‐1α, IL‐6, and TNF‐β induced by AGEs. The expression of IL1α and IL‐6 has been shown to be correlated with chondrocyte cellular senescence, wherein cell division comes to a halt and cells produce increased inflammatory cytokines, thereby driving the progression of OA.[32] TNF‐β, also known as lymphotoxin‐α, is expressed in various immune cells as well as in chondrocytes and drives the production and secretion of proinflammatory cytokines, including IL6, IL‐8, TNF‐α, and matrix‐degrading enzymes, such as matrix metalloproteinases, which target type II collagen for degradation. TNF‐β expression is correlated with an increased risk of knee OA.[33] Thus, the inhibitory effect of Azilsartan on IL‐1α, IL‐6, and TNF‐β expression induced by AGEs may help to delay the progression of OA.
Aggrecan is the primary proteoglycan found in articular cartilage. The articular ECM is a mesh‐like structure composed of rigid type II collagen and saturated with proteoglycan aggregates, which serve to facilitate joint function by absorbing impact from shocks, compressive loading, and mechanical stress. Aggrecanases are proteolytic enzymes that target aggrecan for degradation. ADAMTS‐4 and ADAMTS‐5 induce aggrecan degradation via cleavage at the SELE[15,34] and KEEE[14,17] sites, and then at the interglobular domain. Inhibiting the activity of aggrecanases is widely regarded as a potential therapeutic strategy against OA.[35–37] The Sox C family of transcription factors, which includes Sox4, Sox11, and Sox12, has been studied for its involvement in numerous developmental processes, such as neurodevelopment,[38] inner ear development,[39] skeletogenesis,[40] cartilage growth plate formation,[41] and chondrogenesis.[42] In conjunction with Sox13, Sox4 has been shown to promote the expression of proinflammatory cytokines including IL‐17.[43] Recently, the role of Sox C transcription factors in aggrecan degradation has been revealed. Takahata, et al.[13] found that Sox4 and Sox11 could induce an increase in the expression of ADAMTS‐4 and ADAMTS‐5 in both C3H10T1/2 and SW1353 chondrogenic cell lines, which was induced by retinoic acid. In the present study, we found that exposure of SW1353 cells to AGEs increased Sox4 expression and subsequent expression of ADAMTS‐4 and ADAMTS‐5, which resulted in augmented aggrecan degradation.
The accumulation of AGEs in the ECM is a phenomenal characteristic of aging. Previous studies have shown that the increased levels of AGEs have been found in patients with focal degeneration of cartilage.[44] AGEs promote increased levels of cross‐linking of collagens, which can alter the mechanical properties of cartilage and possibly cause tissue degeneration and OA development.[34] In in vitro chondrocyte experiments, AGEs treatment induces proinflammatory cytokine induction and matrix degradation by the activation MAPK and NF‐κB pathway.[10,45] Therefore, the accumulation of AGEs has been reported as one of the mechanisms for the agerelated development of OA. The limitation of single stimulus AGEs in this study has to be mentioned. To date, most in vitro chondrocyte culture models are to assess the downstream effects in isolation.[46] However, the pathological changes to various stimuli in OA joints are a multifactorial response. The heterogeneity of the cartilage structure and slow progression of OA is the complex system to mimic in vitro.[47] The future in vivo model is required to validate the effect of Azilsartan in OA diseases.
Recent progress has shown that AT1R receptors were increased in various chronic inflammatory disorders, and the receptor is proposed as a novel target of anti‐inflammtory therapy.[48] Azilsartan has been used to suppress AT1R‐mediated inflammation in several inflammatory disease models.[49,50] In rheumatoid arthritis patients, AT1R is upregulated in the synovium of patients.[51] Azilsartan has been proposed as an “Add‐On” treatment medicine for rheumatoid arthritis.[52,53] Our study demonstrates the molecular mechanism of Azilsartan being involved, suggesting that AT1R inhibition has antiinflammatory properties in chondrocytes. Therefore, Azilsartan may have potential implications in the modulation of inflammation in OA therapy.
In conclusion, our findings indicate that the AT1R antagonist Azilsartan may have potential as a therapeutic agent against OA due to its ability to inhibit proinflammatory cytokine production and suppress Sox4‐mediated release of aggrecanases. A graphic presentation of the underlying molecular mechanism is shown in Figure 9. There are several limitations to the current study. Namely, we only observed the effects of Azilsartan in vitro using chondrogenic cell line SW1353 cells. Azilsartan and other Ang II receptor blockers have been reported to have a good safety profile in clinical use,[54] but there is limited research on the role of the RAS in OA.[16] Therefore, further in vivo studies and clinical trials are needed to develop a better understanding of the underlying mechanisms. Additionally, there is presently relatively limited research regarding the role of Sox C family transcription SB203580 factors in OA. Sox C family transcription factors, including Sox4, have been shown to modulate the activity of several signaling pathways, including the Wnt/β‐catenin signaling pathway.[41,55] Thus, further research on the upstream and downstream factors involved in Sox4 signaling is necessary to understand the underlying mechanism and other implications. This study provides a basis for further research into the role of AT1R/Sox4 signaling in OA and other inflammatory diseases.

REFERENCES

[1] W. Zheng, H. Zhang, Y. Jin, Q. Wang, L. Chen, Z. Feng, H. Chen, Y. Wu, Int. Immunopharmacol. 2017, 42, 1.
[2] D. Chen, J. Shen, W. Zhao, T. Wang, L. Han, J. L. Hamilton, H. J. Im, Bone Res. 2017, 5(1), 1.
[3] R. F. Loeser, J. A. Collins, B. O. Diekman, Nat. Rev. Rheumatol. 2016, 12(7), 412.
[4] V. L. Johnson, D. J. Hunter, Best Pract. Res., Clin. Rheumatol. 2014, 28(1), 5.
[5] F. Gao, S. Zhang, Drug Des., Dev. Ther. 2020, 14, 2899.
[6] H. G. Akıllıoğlu, V. Gökmen, in Chemical Hazards in Thermally‐Processed Foods (Ed: S. Wang), Springer, Singapore 2019, pp. 121–151.
[7] S. Rowan, E. Bejarano, A. Taylor, Biochim. Biophys. Acta 2018, 1864(12), 3631.
[8] S. Garg, A. Syngle, K. Vohra, Clin. J. Pain 2013, 29(8), 717.
[9] M. Zhang, J. L. Theleman, K. A. Lygrisse, J. Wang, Gerontology 2019, 65(4), 387.
[10] Z. Rasheed, N. Akhtar, T. M. Haqqi, Rheumatology 2011, 50(5), 838. [11] M. Mittal, M. R. Siddiqui, K. Tran, S. P. Reddy, A. B. Malik, Antioxid.Redox Signaling 2014, 20(7), 1126.
[12] A. Tarannum, A. R. Zarina, A. L. Khursheed, S. Ahmad, M. Uddin, Arch. Rheumatol. 2019, 34(4), 461.
[13] Y. Takahata, E. Nakamura, K. Hata, M. Wakabayashi, T. Murakami, K. Wakamori, H. Yoshikawa, A. Matsuda, N. Fukui, R. Nishimura, FASEB J. 2019, 33(1), 619.
[14] R. A. Santos, W. O. Sampaio, A. C. Alzamora, D. Motta‐Santos, N. Alenina, M. Bader, M. J. Campagnole‐Santos, Physiol. Rev. 2018, 98(1), 505.
[15] M. A. Sparks, S. D. Crowley, S. B. Gurley, M. Mirotsou,T. M. Coffman, Compr. Physiol. 2011, 4(3), 1201.
[16] Y. Wu, X. Lu, M. Li, J. Zeng, J. Zeng, B. Shen, Y. Zeng, Int.Immunopharmacol. 2019, 75, 105796.
[17] D. N. Olschewski, V. Hofschröer, N. Nielsen, D. G. Seidler, A. Schwab, C. Stock, Cell. Physiol. Biochem. 2018, 45(6), 2560.
[18] M. G. Zizzo, G. Caldara, A. Bellanca, D. Nuzzo, M. Di Carlo, R. Serio, Inflammopharmacology 2020, 28(1), 187.
[19] J. Wysocki, M. Ye, E. Rodriguez, F. R. González‐Pacheco, C. Barrios,K. Evora, M. Schuster, H. Loibner, K. B. Brosnihan, C. M. Ferrario,J. M. Penninger, Hypertension 2010, 55(1), 90.
[20] E. Pulcu, L. Shkreli, C. G. Holst, M. L. Woud, M. G. Craske, M. Browning, A. Reinecke, Biol. Psychiatry 2019, 86(5), 397.
[21] R. R. Dargad, J. D. Parekh, R. R. Dargad, S. Kukrety, J. Assoc.Physicians India 2016, 64(3), 96.
[22] M. Ojima, H. Igata, M. Tanaka, H. Sakamoto, T. Kuroita, Y. Kohara, K. Kubo, H. Fuse, Y. Imura, K. Kusumoto, H. Nagaya, J. Pharmacol.Exp. Ther. 2011, 336(3), 801.
[23] E. Ahmadian, A. Y. Khosroushahi, A. Eftekhari, S. Farajnia, H. Babaei, M. A. Eghbal, Biomed. Pharmacother. 2018, 99, 939.
[24] T. W. O′Neill, P. S. McCabe, J. McBeth, Best Pract. Res., Clin.Rheumatol. 2018, 32(2), 312.
[25] A. Mobasheri, G. Kalamegam, G. Musumeci, M. E. Batt, Maturitas 2014, 78(3), 188.
[26] R. R. Bannuru, M. C. Osani, E. E. Vaysbrot, N. K. Arden, K. Bennell,S. M. Bierma‐Zeinstra, V. B. Kraus, L. S. Lohmander, J. H. Abbott,M. Bhandari, F. J. Blanco, Osteoarthritis Cartilage 2019, 27(11), 1578.
[27] A. Neuprez, A. H. Neuprez, J. F. Kaux, W. Kurth, C. Daniel, T. Thirion, J. P. Huskin, P. Gillet, O. Bruyère, J. Y. Reginster, Clin.Rheumatol. 2020, 39(3), 861.
[28] Y. Kawakami, K. Matsuo, M. Murata, K. Yudoh, H. Nakamura, H. Shimizu, M. Beppu, Y. Inaba, T. Saito, T. Kato, K. Masuko, Arthritis 2012, 2012, 1.
[29] C. L. Cheng, Y. Tang, Z. Zheng, X. Liu, C. Y. Zengchun, C. Wang, T. Q. Lou, Clin. Invest. Med. 2012, 35, E282.
[30] X. Xue, Y. Chen, Y. Wang, J. Zhan, B. Chen, X. Wang, X. Pan, Food Funct. 2019, 10(8), 5059.
[31] S. Trellu, A. Courties, S. Jaisson, L. Gorisse, P. Gillery, S. KerdineRömer, C. Vaamonde‐Garcia, X. Houard, F. P. Ekhirch, A. Sautet, B. Friguet, Arthritis Res. Ther. 2019, 21(1), 18.
[32] Y. H. Chen, C. H. Chou, C. Haraden, D. Attarian, V. B. Kraus,Osteoarthritis Cartilage 2019, 27, S94.
[33] L. Han, J. H. Song, J. H. Yoon, Y. G. Park, S. W. Lee, Y. J. Choi, S. W. Nam, J. Y. Lee, W. S. Park, Korean J. Pathol. 2012, 46(1), 30.
[34] M. Lotz, R. F. Loeser, Bone 2012, 51(2), 241.
[35] K. Huang, L. D. Wu, J. Int. Med. Res. 2008, 36(6), 1149.
[36] A. Struglics, L. S. Lohmander, K. Last, J. Akikusa, R. Allen, A. J. Fosang, Arthritis Rheum. 2012, 64(12), 4151.
[37] P. J. Roughley, J. S. Mort, J. Exp. Orthop. 2014, 1(1), 1.
[38] A. Kavyanifar, S. Turan, D. C. Lie, Cell Tissue Res. 2018, 371(1), 91.
[39] K. Gnedeva, A. J. Hudspeth, Proc. Natl. Acad. Sci. U. S. A. 2015, 112(45), 14066.
[40] V. Lefebvre, P. Bhattaram, Curr. Osteoporos. Rep. 2016, 14(1), 32.
[41] K. Kato, P. Bhattaram, A. Penzo‐Méndez, A. Gadi, V. Lefebvre, J. Bone Miner. Res. 2015, 30(9), 1560.
[42] L. Zhang, S. Chen, N. Bao, C. Yang, Y. Ti, L. Zhou, J. Zhao, J. Mol.Histol. 2015, 46(6), 467.
[43] N. Malhotra, K. Narayan, O. H. Cho, K. E. Sylvia, C. Yin, H. Melichar, M. Rashighi, V. Lefebvre, J. E. Harris, L. J. Berg, J. Kang, Immunity 2013, 38(4), 681.
[44] M. M. Steenvoorden, T. W. Huizinga, N. Verzijl, R. A. Bank,H. K. Ronday, H. A. Luning, F. P. Lafeber, R. E. Toes, J. DeGroot, Arthritis Rheum. 2006, 54(1), 253.
[45] C. Ma, Y. Zhang, Y. Q. Li, C. Chen, W. Cai, Y. L. Zeng, PLoS One 2015, 10(5), e0125776.
[46] C. I. Johnson, D. J. Argyle, D. N. Clements, Vet. J. 2016, 209, 40.
[47] P. J. Cope, K. Ourradi, Y. Li, M. Sharif, Osteoarthritis Cartilage 2019, 27(2), 230.
[48] L. Hunyady, K. J. Catt, Mol. Endocrinol. 2006, 20(5), 953.
[49] A. A. De Araújo, H. Varela, C. A. De Medeiros, G. A. De Castro Brito, K. C. De Lima, L. M. De Moura, R. F. De Araújo Júnior, PLoS One 2015, 10(2), e0116799.
[50] W. K. Al‐Hejjaj, I. T. Numan, R. Z. Al‐Sa′ad, S. A. Hussain, Saudi Pharm. J. 2011, 19(1), 29.
[51] Y. Chang, W. Wei, Clin. Exp. Immunol. 2015, 179(2), 137.
[52] N. M. A. Mahmood, S. A. Hussain, H. A. E. K. Khan, BioMed Res. Int.2018, 2018, 7164291.
[53] N. M. A. Mahmood, S. A. Hussain, R. R. Mirza, Ther. Clin. Risk. Manag.2018, 14, 1379.
[54] Y. Shiga, S. I. Miura, K. Motozato, K. Norimatsu, M. Yano, Y. Hitaka, S. Adachi, T. Kuwano, K. Inoue, A. Inoue, K. Fujisawa, Int. Heart J.2017, 58(3), 416.
[55] P. Zhang, J. Li, Y. Song, X. Wang, Cell. Physiol. Biochem. 2017, 42(1), 242.